See the readsynth publication at https://doi.org/10.1186/s12859-024-05809-3
Readsynth simulates Illumina sequenced metagenomes allowing comparison of library approaches including amplicon and reduced metagenome sequencing (RMS). The software takes as input any reference genome sequences in fasta format along with custom primer/restriction enzyme and adapter sequences to simulate the reads expected from an Illumina-based sequencing reaction. Simulated fastq reads capture the expected composition of the input taxa, and are sensitive to changes in the underlying distributions of DNA fragments when digests or size selection are performed.
Readsynth is aimed at optimizing sequencing effort and library prep settings to accurately profile diverse communities of microbial taxa. Use cases may include:
- determining sequencing effort (total reads) required to capture rare taxa
- selecting primers or restriction enzyme schema to capture species richness and diversity
- creating a ground truth for benchmarking profiling software
The preparation of DNA sequencing libraries includes many factors which influence the frequency of a given read, including restriction enzyme site frequency (taxa-dependent), enzyme digestion efficiency, size-selection, as well as the resulting biases caused by preferential DNA fragment length. Readsynth allows users to control common sources of variability introduced in typical enzymatic library preparations.
inputs
- table of locally stored genome assembly files (fasta) and abundance
- desired total number of reads
- restriction enzyme motifs and cut efficiency (can use iso-length REs or 16S/ITS primers)
- size distribution parameters (or locally stored json of custom distribution)
- optional: custom adapter sequences
- optional: pre-existing fastq data to train error profile
- see full list of custom settings in 'optional parameters'
outputs
- simulated fastq file of expected reads (paired end)
- csv of all possible fragments within a specified maximum length (base pairs)
- csv of expected fragment counts given a specified restriction enzyme digestion efficiency
- csv of size-selected fragment counts within a specified Normal distribution of read lengths
- csv summary of reads produced
- individual and stacked distributions before and after size selection (see images below)
First, download readsynth from this github page.
Readsynth is written in Rust. To build the binary, install Rust and run the following from the repository root:
cargo build --release
The compiled binary will be located at target/release/readsynth.
Rust 1.70 or higher (install via rustup)
Readsynth is designed for assessing bacterial and fungal genomes and currently isn't optimized for use with larger eukaryotic genomes. To include larger genomes, it is recommended to split these fasta files into individual sequence files and input each of those into the abundance table. Memory usage will vary: a large sequence length combined with highly abundant motif sites will require enough ram to store every possible fragment produced in the expected fragment distribution.
readsynth -g abundances.csv --m1 EcoRI --m2 T/TAA -n 1000000 -c 0.90 -u 300 --sd 100 -l 150 -o /output_directory
The above example takes 'abundances.csv' as a genome abundance file g with all reference fasta files to be digested with EcoRI (m1) and MseI (m2) in a strand-specific fashion (e.g. the forward adapter always ligates with the /AATTC overhang from EcoRI). Assuming a desired output of 1 million reads (n) will be approximated, digest simulation will calculate the expected number of DNA fragments given the enzyme digestion cut efficiency (c) occurs at a probability of 90% at any random RE motif. The resulting fragments will be size-selected using a normal distribution defined by u and sd. Paired-end Illumina reads of length (l) 150bp will be written to a simulated fastq file (default output has perfect scores). All output (o) will be written to './output_directory' relative to the present working directory where readsynth is called.
relevant input options for reduced sequencing library:
-g G path to genome abundance CSV
-o O path to store output
--m1 M1 [M1 ...] space separated list of search motifs (e.g., RE motifs AluI or AG/CT)
--m2 M2 [M2 ...] space separated list of search motifs (e.g., RE motifs SmlI or C/TYRAG)
-l L desired R1 read length of final simulated reads
-n N total read number
-u U mean (in bp) of read lengths after size selection
--sd SD standard deviation (in bp) of read lengths after size selection
-x X fragment length where fragment distribution intersects size distribution
-d D json dictionary of fragment length:count for all expected bp fragments range
--lp LP low-pass mode: defines maximum expected fragment size, distribution free
readsynth -g abundances.csv --m1 /CCTACGGGNGGCWGCAG --m2 /GACTACHVGGGTATCTAANCC -n 1000000 --lp 1000 -l 150 -o /output_directory
The above example takes 'abundances.csv' as a genome abundance file g with all reference fasta files to be PCR targeted with forward (m1) and reverse (m2) 16S primer sequences in a strand-specific fashion (e.g. the forward adapter always ligates with the forward primer). A desired output of 1 million reads (n) will be approximated. Further, this library avoids applying a gaussian size selection step and utilizes the lp argument to include any amplicon sequences up to a maximum "low-pass" length of 1000bp. Paired-end Illumina reads of length (l) 150bp will be written to a simulated fastq file (default output has perfect scores). All output (o) will be written to './output_directory' relative to the present working directory where readsynth is called.
relevant input options for amplicon library:
-g G path to genome abundance CSV
-o O path to store output
--m1 M1 [M1 ...] space separated list of forward primers (e.g., /CCTACGGGNGGCWGCAG)
--m2 M2 [M2 ...] space separated list of forward primers (e.g., /GACTACHVGGGTATCTAANCC)
-l L desired R1 read length of final simulated reads
-n N total read number
--lp LP low-pass mode: defines maximum expected amplicon size
readsynth -g abundances.csv --iso BcgI -n 1000000 -l 150 --lp 50 -o /output_directory
The above example takes 'abundances.csv' as a genome abundance file g with all reference fasta files to be digested with the isolength (iso) type IIb enzyme BcgI. A desired output of 1 million reads (n) will be approximated. Further, this library avoids applying a gaussian size selection step and utilizes the lp argument to include fragments up to a maximum "low-pass" length of 50bp. Paired-end Illumina reads of length (l) 150bp will be written to a simulated fastq file (default output has perfect scores). All output (o) will be written to './output_directory' relative to the present working directory where readsynth is called.
relevant input options for isolength library:
-g G path to genome abundance CSV
-o O path to store output
--iso ISO type IIB RE motif (e.g., BcgI or NN/NNNNNNNNNNCGANNNNNNTGCNNNNNNNNNNNN/)
-l L desired R1 read length of final simulated reads
-n N total read number
--lp LP low-pass mode: defines maximum expected fragment size
-c C optional: percent probability of per-site cut; default 1 for complete digestion of fragments (fragments will not contain internal RE sites)
--a1 A1 optional: file containing tab/space-separated adapters and barcode that attach 5' to read
--a2 A2 optional: file containing tab/space-separated adapters and barcode that attach 3' to read
--a1s A1S optional: manually provide bp length of adapter a1 before SBS begins
--a2s A2S optional: manually provide bp length of adapter a2 before SBS begins
--q1 Q1 optional: file containing newline-separated R1 Q scores >= length -l
--q2 Q2 optional: file containing newline-separated R2 Q scores >= length -l
-e E optional: filler base to use if full adapter contamination occurs (default: G)
--l2 L2 optional: desired R2 read length of final simulated reads
-t T optional: number of threads for parallel genome processing (default: 1)
--test test mode: skip writing simulated fastq files
When --q1 and --q2 are both provided, readsynth produces two sets of fastq files: the base simulated reads (sim_metagenome_R1/R2.fastq) with quality strings attached, and a second error-simulated set (error_sim_metagenome_R1/R2.fastq) where each base has been stochastically mutated according to its Phred score probability.
--readsynth
|| |
|| |`_ 1a. digest - store seq and pos of possible RE fragments
|| `__ 1b. prob_copies - partially digest genome with n copies
| `___ 2. size_select - size select reads from defined distribution
`____ 3. write_reads - write fragments as paired end fastq-formatted reads
`___ 4. apply_error - apply per-base Phred error simulation (when --q1/--q2 provided)
Given a fasta sequence, the digest module performs a regex search for all m1/m2 restriction motifs. Once a motif hit occurs, the sequence is searched forward within a set range (max, default is mean + 6sd). The start and end position as well as the orientation of the motifs is saved, and sequences are reverse-complemented when oriented on the reverse direction of the reference sequence. Only fragments that contain the m1 motif(s) at the 5' end and the m2 motif(s) at the 3' end will be kept.
Below is a toy genome example of a search for m1=G/AATTC and m2=T/TAA where the maximum fragment length to search forward is 50bp:
_______maximum expected fragment length__________
| |
4 37 48 71
m1 m2 m2 m1
v v v v
GTGAGAATTCGTTGAAAATCCGGTCCTGACGGGACTTTTAACAAGGAATTAAAGATCGCCATAATATTATTGAATTCCC
CACTCTTAAGCAACTTTTAGGCCAGGACTGCCCTGAAAATTGTTCCTTAATTTCTAGCGGTATTATAATAACTTAAGGG
possible fragments:
AATTCGTTGAAAATCCGGTCCTGACGGGACTTT
GCAACTTTTAGGCCAGGACTGCCCTGAAAAT
AATTCGTTGAAAATCCGGTCCTGACGGGACTTTTAACAAGGAAT
GCAACTTTTAGGCCAGGACTGCCCTGAAAATTGTTCCTTAAT
TAACAAGGAAT m2 -> m2 orientation, fragment not kept
TGTTCCTTAAT
TAACAAGGAATTAAAGATCGCCATAATATTATTG
TGTTCCTTAATTTCTAGCGGTATTATAATAACTTAA
TAAAGATCGCCATAATATTATTG
TTCTAGCGGTATTATAATAACTTAA
The resulting fragments are saved in the output directory as a csv-formatted 'raw_digest' file.
Once the raw digest fragments have been determined, the prob_copies module uses the per-site probability of enzyme cleaving (c) to simulate digesting n copy numbers of the input genome. This model captures the non-uniform distribution of fragments where fragments containing intervening cut sites will be less abundant.
Now that we have a baseline number of fragments expected from n number of genome copies with a given digestion efficiency, we use the mean and sd arguments to draw fragments from a Normal distribution. The area under the distribution (number of reads) is grown until reads in the range of mean through mean + 2sd are not under-represented in the sampling process.
In each sequence header, the following components may be useful for a number of analyses:
@62:47:138:34:CGAAGGTGAT:TGCCAAT:full_genome.fna 1
| @ | 62 | 47 | 138 | 34 | CGAAGGTGAT | TGCCAAT | full_genome.fna | 1 |
|---|---|---|---|---|---|---|---|---|
| '@' | fastq index | index of counts file | length of fragment with adapters | length of fragment | p5 adapter id | p7 adapter id | fasta name | r1/r2 read |



